homework7

@

David Liu, a student in the department of Lfe Sciences, got the following mRNA sequence from a rat liver cDNA library.
 

GCGTCGACGGGCTTGGCATCGGGCCTCCGCAGCCGCCCACCGCCAGAAGCTTCCAGCCT

CACCACTATGGATCCCCGCAAAGTGAGCGAGCTTCGGGCCTTCGTGAAGATGTGTAGG

CAGGACCCGAGCGTCCTGCACACCGAGGAAATGCGTTTCCTGAGGGAGTGGGTGGAGA

GCATGGGGGGTAAAGTACCACCTGCTACTCATAAAGCGAAGTCAGAAGAAAACACTAA

GGAAGAAAAAAGAGACAAGACGACAGAGGACAACATAAAGACAGAGGAGCCATCGAG

TGAGGAGAGCGATCTAGAAATTGACAATGAAGGTGTAATTGAAGCAGACACTGATGCT

CCTCAGGAAATGGGAGATGAAAATGCAGAGATAACTGAGGCGATGATGGATGAAGCAA

ATGAAAAGAAGGGGGCTGCCATCGACGCTCTAAATGATGGTGAGCTCCAGAAAGCCAT

TGACTTGTTCACAGACGCCATCAAGCTAAACCCTCGCTTGGCCATTCTGTATGCCAAGA

GAGCCAGTGTTTTCGTCAAATTACAGAAGCCAAATGCTGCCATCCGAGACTGTGACAGA

GCTATTGAAATAAACCCTGATTCAGCTCAGCCATACAAATGGAGAGGGAAAGCGCACA

GACTCCTGGGTCACTGGGAAGAAGCAGCTCGCGATCTTGCCCTGGCCTGTAAATTGGAC

TATGATGAGGACGCCAGTGCAATGCTGAGAGAAGTCCAGCCTCGGGCTCAAAAAATTGC

TGAACATCGGAGAAAGTATGAGCGAAAACGTGAAGAGCGAGAGATAAAAGAACGAAT

AGAAAGGGTGAAGAAGGCTCGAGAAGAGCATGAAAAAGCCCAAAGGGAAGAAGAAGC

CAGAAGACAATCTGGATCTCAGTTTGGCTCTTTTCCAGGTGGTTTTCCTGGGGGAATGC

CTGGTAATTTTCCTGGAGGAATGCCTGGAATGGGAGGGGCCATGCCAGGAATGGCAGG

AATGCCTGGACTCAACGAAATCCTCAGTGACCCAGAGGTTCTTGCAGCCATGCAGGATC

CAGAAGTCATGGTGGCTTTCCAGGATGTGGCCCAGAACCCATCAAATATGTCAAAATAT

CAGAACAACCCAAAGGTTATGAATCTCATCAGTAAATTGTCAGCCAAGTTTGGAGGTCA

CTCATAATGTCAAAGCCCTTGCTGAATGAAGAACAGCTTAGCTCACTTACTGGATGTTG

CAATAATACAAACCAGTGTACCTCTGACCTCACCAGAGAGCTGGGGCGCTTCGAAGATA

ATCCCTACCCTCTGCATCATATGCGGCTGAGGCATATTACAGTGGTTTGCCATTAGAGT

GTTCATTCAGATAATGTTTTCCTATTAGGAATTACAAACTTAAAACATTTTTCAACCTTA

AACATATTTTTTAAAAATTTAGGGGATGTCAATTCCTACATTTTTCGTTACTAATCTTTT

TGGGTTTTTCCTTTTGAATTACTGGGCAAGGAAGGTGAATGTGGATGATTTACTGCTTT

CATGAATGAAATAAAGATTTGTTAGTGGGAAGCAAATAAAACACATTTAAGTTGATTG

AGTCGGACATACGGTTACTGCAACATCTTGAATTGTCTTTAATGTTTTACTTCACAATG

ATCTATTTCAGTAAATCTTTTGGGACCACCAAAAAAAAAAAAAAAAAAAAAAAAA
 

Unfortunately, he doesn't know how to use the sequence analysis tools availabled in the internet since he did not take Bioinformatics before. Could you help him to do the following analysis?
 

(1) Find its corresponding polypeptide sequence (DNA -> Protein translation).

Answer:

          Translation

5'3' Frame 1

Met D P R K V S E L R A F V K Met C R Q D P S V L H T E E Met R F L R E W V E S Met G G K V P P A T H K A K S E E N T K E E K R D K T T E D N I K T E E P S S E E S D L E I D N E G V I E A D T D A P Q E Met G D E N A E I T E A Met Met D E A N E K K G A A I D A L N D G E L Q K A I D L F T D A I K L N P R L A I L Y A K R A S V F V K L Q K P N A A I R D C D R A I E I N P D S A Q P Y K W R G K A H R L L G H W E E A A R D L A L A C K L D Y D E D A S A Met L R E V Q P R A Q K I A E H R R K Y E R K R E E R E I K E R I E R V K K A R E E H E K A Q R E E E A R R Q S G S Q F G S F P G G F P G G Met P G N F P G G Met P G Met G G A Met P G Met A G Met P G L N E I L S D P E V L A A Met Q D P E V Met V A F Q D V A Q N P S N Met S K Y Q N N P K V Met N L I S K L S A K F G G H S

@
 

(2) Identify this protein. Is it a new protein? What kind of rat is this protein belong to? (China, Noway, German.....)

Answer:

           It is not a new protein
 

(3) Report the total number of negatively charged residues and positively charged residues.

Answer:

          protparam
 

(4) Draw the hydrophobicity map for this protein using Eisenberg hydrophobicity scale with window size 7. The relative weight of the window edges compared to the window center
should set to 40%.

Answer:

           protscale
 

(5) Please help him to use Prosite scanning tool to find out possible functions or pattern of this protein.

Answer:

           scanprosite
 

(6) Color the protein by the hydrophobicity of the amino acids.

Answer:
            hydrophobicity