Your query has been submitted, please wait for results

BLASTN 1.4.11 [24-Nov-97] [Build 24-Nov-97]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W.
Myers, and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol.
Biol. 215:403-10.

Notice:  this program and its default parameter settings are optimized
to find nearly identical sequences rapidly.  To identify weak similarities
encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  tmpseq_1
        (605 letters)

Database:  Non-redundant GenBank+EMBL+DDBJ+PDB sequences
           312,067 sequences; 581,488,900 total letters.
Searching..................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

emb|X62395|NTLTP1      N.tabacum ltp1 gene for lipid tran...  2983  7.8e-238  1
gb|U66465|LPU66465     Lycopersicon pennellii lipid trans...  1001  5.7e-73   1
gb|U66466|LPU66466     Lycopersicon pennellii lipid trans...   990  4.7e-72   1
emb|X56040|LETSW12     L.esculentum TSW12 mRNA                 975  8.3e-71   1
dbj|D13952|TOBLTP      Nicotiana tabacum mRNA for lipid t...   966  4.6e-70   1
gb|U81996|LEU81996     Lycopersicon esculentum non specif...   910  2.1e-65   1
gb|M58635|SPILTP       Spinacia oleracea lipid transfer p...   464  2.6e-28   1
gb|U15153|GHU15153     Gossypium hirsutum nonspecific lip...   334  2.2e-24   2
gb|S78173|S78173       LTP=lipid transfer protein {clone ...   334  2.3e-24   2
emb|X96714|PALTP1      P.amygdalus mRNA for lipid transfe...   297  6.9e-24   2
emb|X92648|HALTP       H.annuus mRNA for non-specific lip...   333  7.2e-24   2
emb|X96715|PALTP2      P.amygdalus mRNA for lipid transfe...   351  6.9e-22   2
emb|AJ002958|CAAJ2958  Cicer arietinum mRNA for lipid tra...   383  1.4e-21   1
emb|X92748|BVIWF1      B.vulgaris mRNA for IWF1'               382  1.7e-21   1
gb|M64746|DAREP2LTP    Daucus carota lipid transfer prote...   360  1.2e-19   1
gb|L14770|PPXEPISPEC   Pachyphytum sp. epidermis-specific...   321  2.1e-16   1
gb|L33906|BNALTPWC     Brassica oleracea lipid transfer p...   311  1.4e-15   1
gb|U22175|BNU22175     Brassica napus germination-specifi...   296  2.5e-14   1
gb|L29767|BNALTP       Broccoli lipid transfer protein mR...   296  2.5e-14   1
gb|L33905|BNALTPWB     Brassica oleracea lipid transfer p...   285  2.0e-13   1
gb|U22105|BNU22105     Brassica napus germination-specifi...   276  1.1e-12   1
emb|Z31588|GHLITRPR    G.hybrida (Regina) mRNA for lipid ...   261  2.0e-11   1
gb|U72765|PVU72765     Phaseolus vulgaris non-specific li...   260  2.5e-11   1
gb|U22174|BNU22174     Brassica napus germination-specifi...   258  3.6e-11   1
gb|U64874|GHU64874     Gossypium hirsutum lipid transfer ...   250  1.7e-10   1
gb|M80567|ATHSEQB      A.thaliana non-specific lipid tran...   227  1.4e-08   1
emb|X96716|PALTP3      P.amygdalus mRNA for lipid transfe...   222  3.6e-08   1
gb|AF017358|AF017358   Oryza sativa lipid transfer protei...   215  1.4e-07   1
gb|L31938|BRRBIF38     Brassica rapa (bif38) mRNA, comple...   191  1.3e-05   1
emb|X60318|BNE2        B.napus mRNA, homologous to phosph...   191  1.3e-05   1
gb|U29176|OSU29176     Oryza sativa lipid transfer protei...   160  0.0051    1
dbj|D10955|RIC323PTP   Rice mRNA for Phospholipid transfe...   159  0.0062    1
emb|Z31590|CER01H10    Caenorhabditis elegans cosmid R01H...   158  0.0075    1
emb|X83433|OSLTPB21    O.sativa mRNA for lipid transfer p...   142  0.15      1
emb|Z37114|HVLTPPA     H.vulgare (clone pKG2316) mRNA for...   141  0.18      1
emb|X68655|HVCW18      H.vulgare Cw-18 mRNA                    132  0.66      1
gb|AC002542|AC002542   Human BAC clone RG114A06 from 7q31...   130  0.80      1
gb|U67505|MJU67505     Methanococcus jannaschii from base...   130  0.80      1
emb|X64346|HSGEND      Herpesvirus saimiri complete genom...   128  0.90      1
gb|M31122|HSVSPOLGBP   Herpesvirus saimiri major DNA bind...   128  0.90      1
gb|L40608|PFAVAR1A     Plasmodium falciparum (strain Dd2)...   127  0.94      1
emb|Z81558|CEF59D12    Caenorhabditis elegans cosmid F59D...   125  0.98      1
gb|U67570|MJU67570     Methanococcus jannaschii from base...   126  0.99      2
gb|L48605|C2PVCG       Bacteriophage c2 complete genome.       124  0.994     1
gb|L37091|C2PORF       Bacteriophage c2 (from Lactococcus...   124  0.994     1
emb|Z82278|CEM162      Caenorhabditis elegans cosmid M162...   124  0.994     1
emb|Z34517|LBC2COSS    Lactococcal bacteriophage c2 DNA c...   124  0.994     1
gb|AC000065|HSAC000065 Human BAC clone RG085C05 from 7q21...   128  0.995     2

 

emb|X62395|NTLTP1 N.tabacum ltp1 gene for lipid transferase
            Length = 3112

  Plus Strand HSPs:

 Score = 2983 (824.3 bits), Expect = 7.8e-238, P = 7.8e-238
 Identities = 598/605 (98%), Positives = 598/605 (98%), Strand = Plus / Plus

Query:     1 AATTAATTCTCTCAATCAAATCCAATTTTCTCCCTATAAAAACCCTAAGGTCCTATAGTG 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1178 AATTAATTCTCTCAATCAAATCCAATTTTCTCCCTATAAAAACCCTAAGGTCCTATAGTG 1237

Query:    61 TTCTATATCCAACACTAGCTCCTACTCCCTAAAGCATTTATTATATCTTCCCCTAGCTAG 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1238 TTCTATATCCAACACTAGCTCCTACTCCCTAAAGCATTTATTATATCTTCCCCTAGCTAG 1297

Query:   121 ATACTTCATTCCACAAATAGTTTGCAGCTTTTTCTTTTCCTCTAAAACAATGGAAATAGC 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1298 ATACTTCATTCCACAAATAGTTTGCAGCTTTTTCTTTTCCTCTAAAACAATGGAAATAGC 1357

Query:   181 TGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCACCCTGCGCAGAAGC 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1358 TGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCACCCTGCGCAGAAGC 1417

Query:   241 CATAACCTGTGGCCAGGTTACGTCGAATTTGGCACCTTGTCTTGCTTATCTTAGAAACAC 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1418 CATAACCTGTGGCCAGGTTACGTCGAATTTGGCACCTTGTCTTGCTTATCTTAGAAACAC 1477

Query:   301 GGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCAC 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1478 GGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCAC 1537

Query:   361 AGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAAT 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1538 AGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAAT 1597

Query:   421 CAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGAT 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1598 CAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGAT 1657

Query:   481 CAGCCCTTCCACTGACTGCTCCAAGTACCTCACNNNNNNNCTCTCTCATGCTATTCTTAT 540
             |||||||||||||||||||||||||||||||||       ||||||||||||||||||||
Sbjct:  1658 CAGCCCTTCCACTGACTGCTCCAAGTACCTCACTTTTTTTCTCTCTCATGCTATTCTTAT 1717

Query:   541 CCTTATATTCTATCTGCTTCATTTTCGCTTATCTTTTAAATTTTTTATTCGGAATCTTTA 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  1718 CCTTATATTCTATCTGCTTCATTTTCGCTTATCTTTTAAATTTTTTATTCGGAATCTTTA 1777

Query:   601 TACCA 605
             |||||
Sbjct:  1778 TACCA 1782

 

gb|U66465|LPU66465 Lycopersicon pennellii lipid transfer protein 1
            (LpLTP1) gene, complete cds
            Length = 2033

  Plus Strand HSPs:

 Score = 1001 (276.6 bits), Expect = 5.7e-73, P = 5.7e-73
 Identities = 289/400 (72%), Positives = 289/400 (72%), Strand = Plus / Plus

Query:   108 TTCCCCTAGCTAGATACTTCATTCCACAAATAGTTTGCAGCTTTTTCTTTTCCTCTAAAA 167
             ||| ||   ||| |  ||| | |  |  | ||   |     |||||| ||  |  ||| |
Sbjct:   573 TTCACCATACTATACTCTTTACTATAATATTATCCTCTCTATTTTTCATTATCATTAACA 632

Query:   168 CAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCAC 227
               |||||||| | | | |||||||||||||||||  | ||||||||||| || | |||||
Sbjct:   633 ATATGGAAATGGTTAGCAAAATTGCATGCTTTGTTCTTTTGTGCATGGTAGTGGTTGCAC 692

Query:   228 CCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAATTTGGCACCTTGTCTTGCTT 287
             ||   ||||| ||  |||| ||||| || |||||  |    ||||| ||||| ||  |||
Sbjct:   693 CCCATGCAGAGGCACTAACTTGTGGTCAAGTTACCGCTGGCTTGGCTCCTTGCCTCCCTT 752

Query:   288 ATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATT 347
             |||||  |  |   || ||||| ||| | ||||| ||||| ||||||| |||| ||  ||
Sbjct:   753 ATCTTCAAGGCCGCGGCCCTCTAGGAGGCTGTTGTGGTGGTGTTAAGGGTCTGTTGGGTT 812

Query:   348 CTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTG 407
             | || | ||| || |  |||||  | |  |||||||||||| |||||||||||||   ||
Sbjct:   813 CAGCCAAGACTACCGCGGATCGAAAGACCGCATGCACTTGCTTGAAATCAGCTGCTAATG 872

Query:   408 CTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATA 467
             ||||    |||||  |||||  ||||||||||||| | ||||||  ||||   || || |
Sbjct:   873 CTATAAAGGGAATTGATTTGAACAAAGCTGCTGGTATTCCTAGTGTTTGTAAAGTTAACA 932

Query:   468 TTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAGTA 507
             ||||||||||||||||||| |||||||||||||||| |||
Sbjct:   933 TTCCTTACAAGATCAGCCCCTCCACTGACTGCTCCACGTA 972

 

gb|U66466|LPU66466 Lycopersicon pennellii lipid transfer protein 2
            (LpLTP2) gene, complete cds
            Length = 1854

  Plus Strand HSPs:

 Score = 990 (273.6 bits), Expect = 4.7e-72, P = 4.7e-72
 Identities = 262/342 (76%), Positives = 262/342 (76%), Strand = Plus / Plus

Query:   166 AACAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGC 225
             || ||||||||| | |   || ||||||||||||||| | || |||||||| || | |||
Sbjct:   703 AAGAATGGAAATGGTTAACAAGATTGCATGCTTTGTGCTTTTATGCATGGTAGTGGTTGC 762

Query:   226 ACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAATTTGGCACCTTGTCTTGC 285
             ||||   ||||| ||  |||| ||||| || ||||| || |  ||||| ||||||||  |
Sbjct:   763 ACCCCATGCAGAGGCACTAACTTGTGGTCAAGTTACATCTACCTTGGCTCCTTGTCTCCC 822

Query:   286 TTATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAA 345
             |||||| |  ||    || ||||| ||| | ||||| ||||| ||||||| |||  ||  
Sbjct:   823 TTATCTAATGAATCGCGGTCCTCTCGGAGGCTGTTGTGGTGGTGTTAAGGGTCTTTTGGG 882

Query:   346 TTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGG 405
             |   ||   ||| |||| ||| || || |  |||||||||||||| |||||||||||   
Sbjct:   883 TCAAGCCCAGACTACAGTAGACCGACAGACCGCATGCACTTGCCTAAAATCAGCTGCTTC 942

Query:   406 TGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAA 465
             | || || | ||  |  ||||||||||||||||| |||||||||| |||||| |||||||
Sbjct:   943 TTCTTTTACAGGCCTTGATTTGGGCAAAGCTGCTAGTCTCCCTAGCACTTGTAGTGTCAA 1002

Query:   466 TATTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAGTA 507
              || ||||||||||||||||| || ||||||||||| |||||
Sbjct:  1003 CATCCCTTACAAGATCAGCCCCTCTACTGACTGCTCTAAGTA 1044

 

emb|X56040|LETSW12 L.esculentum TSW12 mRNA
            Length = 675

  Plus Strand HSPs:

 Score = 975 (269.4 bits), Expect = 8.3e-71, P = 8.3e-71
 Identities = 267/357 (74%), Positives = 267/357 (74%), Strand = Plus / Plus

Query:   149 TTTTTCTTTTCCTCTAAAACAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTG 208
             |||||| ||  |  ||| |  |||||||| | | | |||||||||||||||||  | |||
Sbjct:    72 TTTTTCATTATCATTAACAATATGGAAATGGTTAGCAAAATTGCATGCTTTGTTCTTTTG 131

Query:   209 TGCATGGTGGTAGCTGCACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAAT 268
             |||||||| || | |||||||   ||||| ||  |||| ||||| || |||||  |    
Sbjct:   132 TGCATGGTAGTGGTTGCACCCCATGCAGAGGCATTAACTTGTGGTCAAGTTACTGCTGGC 191

Query:   269 TTGGCACCTTGTCTTGCTTATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGC 328
             ||||| ||||| ||  ||||||||  |  |   || ||||| ||| | ||||| ||||| 
Sbjct:   192 TTGGCTCCTTGCCTCCCTTATCTTCAAGGCCGTGGCCCTCTAGGAGGCTGTTGTGGTGGT 251

Query:   329 GTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGC 388
             ||||||  |||| ||  ||| || | ||| || |  |||||  | |  ||||||||||||
Sbjct:   252 GTTAAGAATCTGTTGGGTTCAGCCAAGACTACCGCGGATCGAAAGACAGCATGCACTTGC 311

Query:   389 CTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCT 448
              |||||||||||||   ||||||    |||||  |||||  ||||||||||||| | |||
Sbjct:   312 TTGAAATCAGCTGCTAATGCTATAAAGGGAATTGATTTGAACAAAGCTGCTGGTATTCCT 371

Query:   449 AGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAG 505
             |||  ||||   || || |||||||||||||||||||| |||||||||||||||| |
Sbjct:   372 AGTGTTTGTAAAGTTAACATTCCTTACAAGATCAGCCCCTCCACTGACTGCTCCACG 428

 

dbj|D13952|TOBLTP Nicotiana tabacum mRNA for lipid transfer protein
            Length = 661

  Plus Strand HSPs:

 Score = 966 (266.9 bits), Expect = 4.6e-70, P = 4.6e-70
 Identities = 290/411 (70%), Positives = 290/411 (70%), Strand = Plus / Plus

Query:    99 TATTATATCTTCCCCTAGCTAGATACTTCATTCCACAAATAGTTTGCAGCTTTTTCTTTT 158
             ||||||| | | | |||  | ||  | | |  | |||     ||      | || |    
Sbjct:    22 TATTATACCCTTCACTACTTCGAATCCTGACACTACACTCTATTGTTTTATCTTCCCCCA 81

Query:   159 CCTCTAAAACAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGG 218
               | |  || ||||||||| |  || || ||||||||||||||||| |||||||||||||
Sbjct:    82 ATTTTTTAAGAATGGAAATGGTAGGTAAGATTGCATGCTTTGTGGTTTTGTGCATGGTGG 141

Query:   219 TAGCTGCACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAATTTGGCACCTT 278
             | | |||||||   ||||| ||  | | ||| ||||| |||  |||    ||||| ||||
Sbjct:   142 TGGTTGCACCCCATGCAGAGGCACTGAGCTGCGGCCAAGTTCAGTCCGGCTTGGCTCCTT 201

Query:   279 GTCTTGCTTATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTC 338
             ||||  ||||| |      |   || ||| ||||  | ||||| ||||| ||||| | ||
Sbjct:   202 GTCTCCCTTATTTGCAGGGCCGCGGCCCTTTGGGGAGCTGTTGTGGTGGTGTTAAAGGTC 261

Query:   339 TGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAG 398
             || ||  | | || | | ||  |   || ||  | | ||||||||||||||||||||| |
Sbjct:   262 TGTTGGGTGCAGCCAAGTCCCTATCTGACCGGAAGACTGCATGCACTTGCCTGAAATCGG 321

Query:   399 CTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTG 458
             ||||   |||||||   || ||  || |||||||||| |||||||||||| || ||||||
Sbjct:   322 CTGCTAATGCTATTAAGGGTATTGATATGGGCAAAGCCGCTGGTCTCCCTGGTGCTTGTG 381

Query:   459 GTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAGTACC 509
             ||||||| |||||||||||||||||||| ||||| |||||||| |||  ||
Sbjct:   382 GTGTCAACATTCCTTACAAGATCAGCCCCTCCACAGACTGCTCTAAGGTCC 432

 

gb|U81996|LEU81996 Lycopersicon esculentum non specific lipid transfer
            protein (le16) mRNA, complete cds
            Length = 583

  Plus Strand HSPs:

 Score = 910 (251.4 bits), Expect = 2.1e-65, P = 2.1e-65
 Identities = 258/353 (73%), Positives = 258/353 (73%), Strand = Plus / Plus

Query:   157 TTCCTCTAAAACAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGT 216
             ||  | || || |||||||||   ||| |||||||||||||||||||| || ||||||||
Sbjct:     2 TTTTTTTATAAGAATGGAAATGTTTGGAAAAATTGCATGCTTTGTGGTTTTTTGCATGGT 61

Query:   217 GGTAGCTGCACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAATTTGGCACC 276
             ||| | |||||||   |||||  |  | | ||| ||| ||||||||||    ||||| ||
Sbjct:    62 GGTGGTTGCACCCCATGCAGAGTCACTGAGCTGCGGCGAGGTTACGTCTGGCTTGGCTCC 121

Query:   277 TTGTCTTGCTTATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGC 336
             ||||||  |||||||          || ||||| ||| | ||||| ||||| ||||||| 
Sbjct:   122 TTGTCTCCCTTATCTCGAGGGTCGCGGCCCTCTAGGAGGGTGTTGTGGTGGTGTTAAGGG 181

Query:   337 TCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATC 396
             |||  ||    | || | |||| ||||||| ||  | |  || ||||||||||| |||||
Sbjct:   182 TCTATTGGGCGCAGCCAAGACCCCAGAAGACCGGAAGACAGCGTGCACTTGCCTTAAATC 241

Query:   397 AGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTG 456
              || ||   | |||||   || ||  ||   || ||||| ||||| |||||| |   |||
Sbjct:   242 GGCAGCTAATTCTATTAAGGGCATTGATACAGGAAAAGCCGCTGGGCTCCCTGGAGTTTG 301

Query:   457 TGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAGTACC 509
             ||| ||||| ||||||||||||||||||||||||||||| ||||| | |  ||
Sbjct:   302 TGGAGTCAACATTCCTTACAAGATCAGCCCTTCCACTGATTGCTCAACGGTCC 354

 

gb|M58635|SPILTP Spinacia oleracea lipid transfer protein mRNA, complete cds.
            Length = 555

  Plus Strand HSPs:

 Score = 464 (128.2 bits), Expect = 2.6e-28, P = 2.6e-28
 Identities = 180/289 (62%), Positives = 180/289 (62%), Strand = Plus / Plus

Query:   211 CATGGTGGTAGCTGCACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAATTT 270
             | |||| |  ||  ||  |   | || ||  ||||| |||||   |||| |    ||  |
Sbjct:    64 CGTGGTCGCTGCACCATACGCTGAAGCAGGTATAACTTGTGGGATGGTTTCAAGCAAACT 123

Query:   271 GGCACCTTGTCTTGCTTATCTTAGAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGT 330
              || |||||  |||  || |||| |               ||  |||| || |||||  |
Sbjct:   124 TGCTCCTTGCATTGGGTACCTTAAAGGAGGCCCCTTGGGCGGTGGTTGCTGTGGTGGAAT 183

Query:   331 TAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCT 390
             |||||| |||       | ||    |||||    ||  |  ||| |||||||| ||||||
Sbjct:   184 TAAGGCCCTGAACGCGGCAGCTGCCACCACTCCTGACAGGAAAACTGCATGCAATTGCCT 243

Query:   391 GAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAG 450
              |||   |||||   ||| |||   |||||||| |  || || ||||||||||||||| |
Sbjct:   244 CAAAAGTGCTGCTAATGCCATTAAGGGAATCAACTACGGAAAGGCTGCTGGTCTCCCTGG 303

Query:   451 TACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGC 499
             ||  ||||| ||| ||||||| |||   || |||||   |||  |||||
Sbjct:   304 TATGTGTGGCGTCCATATTCCCTACGCCATTAGCCCCAGCACCAACTGC 352

 

gb|U15153|GHU15153 Gossypium hirsutum nonspecific lipid transfer
            protein precursor mRNA, complete cds.
            Length = 592

  Plus Strand HSPs:

 Score = 158 (43.7 bits), Expect = 2.2e-24, Sum P(2) = 2.2e-24
 Identities = 42/55 (76%), Positives = 42/55 (76%), Strand = Plus / Plus

Query:   185 AAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCACCCTGCGCAGAAG 239
             ||| |||||||  | ||||| ||||||||||| || | |||||||   ||  |||
Sbjct:    99 AAACTTGCATGTGTGGTGGTGTTGTGCATGGTAGTGGGTGCACCCCTGGCTCAAG 153

 Score = 334 (92.3 bits), Expect = 2.2e-24, Sum P(2) = 2.2e-24
 Identities = 122/191 (63%), Positives = 122/191 (63%), Strand = Plus / Plus

Query:   313 ACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCA 372
             | |||| |||   ||| | ||  ||||        | ||    || |||  ||  || ||
Sbjct:   239 AGGTTGCTGCACGGGCATCAAATCTCTCAACTCCGCCGCCCAAACAACACCAGTCCGGCA 298

Query:   373 AATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAA 432
             |   || ||||  ||| | |||   || || |  |  ||| |||| ||||| || |||  
Sbjct:   299 AGCAGCTTGCAGATGCATCAAAAGTGCGGCCGCCGGCATTACTGGCATCAACTTTGGCCT 358

Query:   433 AGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCAC 492
              ||    || |||||  | |  || |||||||| || ||||||||||||||||||  |||
Sbjct:   359 TGCAAGCGGACTCCCAGGCAAGTGCGGTGTCAACATCCCTTACAAGATCAGCCCTAGCAC 418

Query:   493 TGACTGCTCCA 503
             |||||||  ||
Sbjct:   419 TGACTGCAACA 429

 

gb|S78173|S78173 LTP=lipid transfer protein {clone GH3} [Gossypium
            hirsutum=cotton, fiber, mRNA, 609 nt]
            Length = 609

  Plus Strand HSPs:

 Score = 158 (43.7 bits), Expect = 2.3e-24, Sum P(2) = 2.3e-24
 Identities = 42/55 (76%), Positives = 42/55 (76%), Strand = Plus / Plus

Query:   185 AAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCACCCTGCGCAGAAG 239
             ||| |||||||  | ||||| ||||||||||| || | |||||||   ||  |||
Sbjct:    99 AAACTTGCATGTGTGGTGGTGTTGTGCATGGTAGTGGGTGCACCCCTGGCTCAAG 153

 Score = 334 (92.3 bits), Expect = 2.3e-24, Sum P(2) = 2.3e-24
 Identities = 122/191 (63%), Positives = 122/191 (63%), Strand = Plus / Plus

Query:   313 ACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCA 372
             | |||| |||   ||| | ||  ||||        | ||    || |||  ||  || ||
Sbjct:   239 AGGTTGCTGCACGGGCATCAAATCTCTCAACTCCGCCGCCCAAACAACACCAGTCCGGCA 298

Query:   373 AATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAA 432
             |   || ||||  ||| | |||   || || |  |  ||| |||| ||||| || |||  
Sbjct:   299 AGCAGCTTGCAGATGCATCAAAAGTGCGGCCGCCGGCATTACTGGCATCAACTTTGGCCT 358

Query:   433 AGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCAC 492
              ||    || |||||  | |  || |||||||| || ||||||||||||||||||  |||
Sbjct:   359 TGCAAGCGGACTCCCAGGCAAGTGCGGTGTCAACATCCCTTACAAGATCAGCCCTAGCAC 418

Query:   493 TGACTGCTCCA 503
             |||||||  ||
Sbjct:   419 TGACTGCAACA 429

 

emb|X96714|PALTP1 P.amygdalus mRNA for lipid transfer protein I
            Length = 594

  Plus Strand HSPs:

 Score = 189 (52.2 bits), Expect = 6.9e-24, Sum P(2) = 6.9e-24
 Identities = 77/126 (61%), Positives = 77/126 (61%), Strand = Plus / Plus

Query:   185 AAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTGCACCCTGCGCAGAAGCCATA 244
             ||  |||| |   | ||||  ||||||||||| ||    |  |||   ||  ||||||||
Sbjct:    89 AAGCTTGCTTTGGTGGTGGCCTTGTGCATGGTTGTGAGCGTGCCCATTGCTCAAGCCATA 148

Query:   245 ACCTGTGGCCAGGTTACGTCGAATTTGGCACCTTGTCTTGCTTATCTTAGAAACACGGGG 304
             || |||||||| ||  |    ||  | ||||| ||  |  | ||  | |||  |   || 
Sbjct:   149 ACATGTGGCCAAGTGTCCAGCAACCTTGCACCATGCATACCCTACGTGAGAGGCGGTGGA 208

Query:   305 CCTCTG 310
              || ||
Sbjct:   209 GCTGTG 214

 Score = 297 (82.1 bits), Expect = 6.9e-24, Sum P(2) = 6.9e-24
 Identities = 117/189 (61%), Positives = 117/189 (61%), Strand = Plus / Plus

Query:   316 TTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAAT 375
             ||| |||   ||| ||| |    |    || |  |||||||||||    || || ||   
Sbjct:   223 TTGCTGCAACGGCATTAGGAACGTCAACAACTTGGCAAGGACCACCCCTGACCGCCAGGC 282

Query:   376 TGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGC 435
              || ||||  |||||||||     | | |      |  | ||| ||||      ||| ||
Sbjct:   283 CGCTTGCAACTGCCTGAAACAGCTTTCCGCCAGCGTCCCCGGAGTCAACCCTAACAATGC 342

Query:   436 TGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGA 495
              || |  || ||  | |  ||||| || |||||||||||| |||| ||||| |||||  |
Sbjct:   343 CGCAGCGCTTCCCGGCAAGTGTGGAGTTAATATTCCTTACCAGATTAGCCCCTCCACCAA 402

Query:   496 CTGCTCCAA 504
             |||| ||||
Sbjct:   403 CTGCGCCAA 411

 

emb|X92648|HALTP H.annuus mRNA for non-specific lipid-transfer protein
            Length = 520

  Plus Strand HSPs:

 Score = 152 (42.0 bits), Expect = 7.2e-24, Sum P(2) = 7.2e-24
 Identities = 64/106 (60%), Positives = 64/106 (60%), Strand = Plus / Plus

Query:   209 TGCATGGTGGTAGCTGCACCCTGCGCAGAAGCCATAACCTGTGGCCAGGTTACGTCGAAT 268
             ||||||||||| | ||||||||   | || ||  | | ||| || || ||  |    |  
Sbjct:    82 TGCATGGTGGTGGGTGCACCCTATACCGAGGCTCTTAGCTGCGGTCAAGTATCCAGCAGC 141

Query:   269 TTGGCACCTTGTCTTGCTTATCTTAGAAACACGGGGCCTCTGGGAC 314
             || ||||| ||  |  | || || |  ||    ||  || ||  ||
Sbjct:   142 TTAGCACCGTGCATCTCCTACCTAACCAAAGGTGGTGCTGTGCCAC 187

 Score = 333 (92.0 bits), Expect = 7.2e-24, Sum P(2) = 7.2e-24
 Identities = 121/189 (64%), Positives = 121/189 (64%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||| |||| || ||  | ||    |   ||||||  || ||    ||||| ||   |
Sbjct:   193 TGCTGCAGTGGGGTAAAATCACTCAATAGCGCTGCAAAAACAACCCCTGATCGCCAGGCT 252

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             |||||   |||| | ||    |||     | | || || ||  ||||    ||||| || 
Sbjct:   253 GCATGTGGTTGCTTAAAGAGCGCTTACAATTCCATCTCCGGCGTCAACGCTGGCAATGCC 312

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||  |  ||||  | |  ||||||||||  || |||||||||||||||||   ||| || 
Sbjct:   313 GCCAGCTTCCCAGGCAAGTGTGGTGTCAGCATCCCTTACAAGATCAGCCCAAGCACCGAT 372

Query:   497 TGCTCCAAG 505
             |||||||||
Sbjct:   373 TGCTCCAAG 381

 

emb|X96715|PALTP2 P.amygdalus mRNA for lipid transfer protein II
            Length = 636

  Plus Strand HSPs:

 Score = 111 (30.7 bits), Expect = 6.9e-22, Sum P(2) = 6.9e-22
 Identities = 23/24 (95%), Positives = 23/24 (95%), Strand = Plus / Plus

Query:   207 TGTGCATGGTGGTAGCTGCACCCT 230
             ||||||||||||| ||||||||||
Sbjct:   102 TGTGCATGGTGGTGGCTGCACCCT 125

 Score = 351 (97.0 bits), Expect = 6.9e-22, Sum P(2) = 6.9e-22
 Identities = 107/153 (69%), Positives = 107/153 (69%), Strand = Plus / Plus

Query:   347 TCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGT 406
             || || | ||||||||  |||||  ||||  | ||||  ||| ||||| ||| ||| || 
Sbjct:   252 TCAGCCACGACCACAGCTGATCGCAAAATGCCTTGCAAGTGCTTGAAAACAGTTGCTGGC 311

Query:   407 GCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAAT 466
             ||  |    || || ||    ||| | |||||||  || |||      ||||| ||||| 
Sbjct:   312 GCAGTCAAAGGCATAAACACAGGCTACGCTGCTGCCCTTCCTTCCTTGTGTGGCGTCAAA 371

Query:   467 ATTCCTTACAAGATCAGCCCTTCCACTGACTGC 499
             ||||| |||||||||||| | |||||| |||||
Sbjct:   372 ATTCCCTACAAGATCAGCGCCTCCACTAACTGC 404

 

emb|AJ002958|CAAJ2958 Cicer arietinum mRNA for lipid transfer protein
            Length = 638

  Plus Strand HSPs:

 Score = 383 (105.8 bits), Expect = 1.4e-21, P = 1.4e-21
 Identities = 131/199 (65%), Positives = 131/199 (65%), Strand = Plus / Plus

Query:   300 CGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCA 359
             | || |||   | ||  || || ||||| |||| |   ||      | | ||    ||||
Sbjct:   194 CTGGTCCTTCAGCACAATGCTGTGGTGGAGTTAGGAACCTTAATTCTGCAGCTGTTACCA 253

Query:   360 CAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAA 419
             ||   |||||||||  ||| || |  ||  |||||   ||||| ||| |||||||| |  
Sbjct:   254 CACCTGATCGTCAAGCTGCTTGTAACTGTTTGAAAAGTGCTGCTGGTTCTATTTCTCGTT 313

Query:   420 TCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGA 479
             | |||     ||| ||||||| ||||||| | |  ||||  || || |||||||||||||
Sbjct:   314 TGAATGCTAACAATGCTGCTGCTCTCCCTGGCAAATGTGTGGTTAACATTCCTTACAAGA 373

Query:   480 TCAGCCCTTCCACTGACTG 498
             | ||  | |||||  ||||
Sbjct:   374 TTAGTACCTCCACCAACTG 392

 

emb|X92748|BVIWF1 B.vulgaris mRNA for IWF1'
            Length = 656

  Plus Strand HSPs:

 Score = 382 (105.6 bits), Expect = 1.7e-21, P = 1.7e-21
 Identities = 134/206 (65%), Positives = 134/206 (65%), Strand = Plus / Plus

Query:   294 GAAACACGGGGCCTCTGGGACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAA 353
             ||  | | || ||   ||    ||| ||||||||  |||||   ||    |   | ||  
Sbjct:   230 GAGCCCCCGGCCCCTCGGCGGCTTGCTGCGGTGGGATTAAGAGCCTCAATAGCGCGGCTG 289

Query:   354 GGACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTT 413
                || | |  ||  |  ||| ||||||||||||||| ||||| |||||   | | ||| 
Sbjct:   290 CCTCCCCTGCTGACAGGAAAACTGCATGCACTTGCCTCAAATCTGCTGCTACTTCCATTA 349

Query:   414 CTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTT 473
               |||||||| |  || || || ||| ||||||||||    |||||||||| | |||| |
Sbjct:   350 AGGGAATCAACTACGGAAAGGCCGCTAGTCTCCCTAGACAATGTGGTGTCAGTGTTCCCT 409

Query:   474 ACAAGATCAGCCCTTCCACTGACTGC 499
             ||   || ||||||  |||  |||||
Sbjct:   410 ACGCCATTAGCCCTAACACCAACTGC 435

 

gb|M64746|DAREP2LTP Daucus carota lipid transfer protein mRNA, complete cds.
            Length = 737

  Plus Strand HSPs:

 Score = 360 (99.5 bits), Expect = 1.2e-19, P = 1.2e-19
 Identities = 124/189 (65%), Positives = 124/189 (65%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             ||||||  ||  || | ||  ||    ||  ||||| ||||||||   ||    |  |  
Sbjct:   242 TGTTGCAATGTTGTGAGGGGACTCAATAACGCTGCACGGACCACACTCGACAAGCGCACC 301

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || |||   ||||| ||   | | ||   |||  |  ||||  |||| |||  |   |||
Sbjct:   302 GCTTGCGGCTGCCTCAAGCAAACGGCTAATGCCGTCACTGGTCTCAACTTGAACGCTGCT 361

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||||| ||||||  ||  ||||||||||| ||||||||||| ||||||||  |||| || 
Sbjct:   362 GCTGGCCTCCCTGCTAGATGTGGTGTCAACATTCCTTACAAAATCAGCCCCACCACCGAT 421

Query:   497 TGCTCCAAG 505
             |||  || |
Sbjct:   422 TGCAACAGG 430

 

gb|L14770|PPXEPISPEC Pachyphytum sp. epidermis-specific transcript,
            complete exon.
            Length = 560

  Plus Strand HSPs:

 Score = 321 (88.7 bits), Expect = 2.1e-16, P = 2.1e-16
 Identities = 117/183 (63%), Positives = 117/183 (63%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||||||||  | |||   || ||   |   || |   |||||   || || |||| |
Sbjct:   191 TGCTGCGGTGGGATCAAGAGCCTTGTCGGTAAAGCCAACTCCACACCGGACCGCCAAACT 250

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             ||||| |  ||  ||||| |    ||        || | ||  | ||| |||||| || |
Sbjct:   251 GCATGTAGGTGTTTGAAAACTCTAGCTTCGAAAGTTCCAGGTGTGAATATGGGCACAGTT 310

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
              ||    |||||||    |||||||| | |||||| ||||||||||| |  |||||| ||
Sbjct:   311 TCTAAGATCCCTAGCCAATGTGGTGTTAGTATTCCCTACAAGATCAGTCTCTCCACTAAC 370

Query:   497 TGC 499
             |||
Sbjct:   371 TGC 373

 

gb|L33906|BNALTPWC Brassica oleracea lipid transfer protein (wax9C)
            gene, exon 1-2. gb|L33907|BNALTPWD Brassica oleracea lipid transfer
            protein (wax9D) gene, exon 1-2.
            Length = 3603

  Plus Strand HSPs:

 Score = 311 (85.9 bits), Expect = 1.4e-15, P = 1.4e-15
 Identities = 126/211 (59%), Positives = 126/211 (59%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||| | |||||||    |||    ||    ||  | || ||   ||| |||||    
Sbjct:  1132 TGCTGCAGCGGCGTTACTAGTCTAAACAACATGGCCCGTACAACCCCAGACCGTCAGCAA 1191

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || |||  ||||||   |  ||| ||    ||  |  ||   |||||  | | |   || 
Sbjct:  1192 GCTTGCCGTTGCCTTGTAGGAGCCGCTAACGCCTTGCCTACTATCAACGTTGCCCGTGCA 1251

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||||| || ||||   | ||||| ||||| ||||||||||||||||||    ||||  ||
Sbjct:  1252 GCTGGACTTCCTAAGGCATGTGGAGTCAACATTCCTTACAAGATCAGCAAAACCACCAAC 1311

Query:   497 TGCTCCAAGTACCTCACNNNNNNNCTCTCTC 527
             |||  || |||  |          || ||||
Sbjct:  1312 TGCAACAGGTATATATGTCTTAATCTGTCTC 1342

 

gb|U22175|BNU22175 Brassica napus germination-specific lipid transfer
            protein 3 mRNA, complete cds.
            Length = 614

  Plus Strand HSPs:

 Score = 296 (81.8 bits), Expect = 2.5e-14, P = 2.5e-14
 Identities = 116/187 (62%), Positives = 116/187 (62%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||| | |||||||    |||    ||    ||  | || ||   ||| |||||    
Sbjct:   219 TGCTGCAGCGGCGTTACTAGTCTAAACAACATGGCCCGTACAACCCCAGACCGTCAGCAA 278

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || |||  ||||||   |  ||| ||    ||  |  ||   |||||  | | |   || 
Sbjct:   279 GCTTGCCGTTGCCTTGTAGGAGCCGCTAACGCCTTGCCTACTATCAACGTTGCCCGTGCA 338

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||||| || ||||   | ||||| ||||| ||||||||||||||||||    ||||  ||
Sbjct:   339 GCTGGACTTCCTAAGGCATGTGGAGTCAACATTCCTTACAAGATCAGCAAAACCACCAAC 398

Query:   497 TGCTCCA 503
             |||  ||
Sbjct:   399 TGCAACA 405

 

gb|L29767|BNALTP Broccoli lipid transfer protein mRNA, complete cds.
            Length = 606

  Plus Strand HSPs:

 Score = 296 (81.8 bits), Expect = 2.5e-14, P = 2.5e-14
 Identities = 116/187 (62%), Positives = 116/187 (62%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||| | |||||||    |||    ||    ||  | || ||   ||| |||||    
Sbjct:   219 TGCTGCAGCGGCGTTACTAGTCTAAACAACATGGCCCGTACAACCCCAGACCGTCAGCAA 278

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || |||  ||||||   |  ||| ||    ||  |  ||   |||||  | | |   || 
Sbjct:   279 GCTTGCCGTTGCCTTGTAGGAGCCGCTAACGCCTTGCCTACTATCAACGTTGCCCGTGCA 338

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||||| || ||||   | ||||| ||||| ||||||||||||||||||    ||||  ||
Sbjct:   339 GCTGGACTTCCTAAGGCATGTGGAGTCAACATTCCTTACAAGATCAGCAAAACCACCAAC 398

Query:   497 TGCTCCA 503
             |||  ||
Sbjct:   399 TGCAACA 405

 

gb|L33905|BNALTPWB Brassica oleracea lipid transfer protein (wax9B)
            gene, exon 1-2.
            Length = 1529

  Plus Strand HSPs:

 Score = 285 (78.8 bits), Expect = 2.0e-13, P = 2.0e-13
 Identities = 124/213 (58%), Positives = 124/213 (58%), Strand = Plus / Plus

Query:   312 GACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTC 371
             || | || |||  ||||||||    |||    ||    ||  | || ||    || ||||
Sbjct:   910 GAGGGTGCTGCACTGGCGTTACTAATCTAAACAACATGGCCCGTACAACCCCGGACCGTC 969

Query:   372 AAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCA 431
             |    || |||  ||||||   |  ||| ||     |  |  ||    ||||    | | 
Sbjct:   970 AGCAAGCTTGCCGTTGCCTTGTAGGAGCCGCTAACTCCTTCCCTACTCTCAACGCTGCCC 1029

Query:   432 AAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCA 491
               |||||||| || ||||   | ||||| ||||||||||||||||| ||||||     ||
Sbjct:  1030 GTGCTGCTGGACTTCCTAAGGCATGTGGAGTCAATATTCCTTACAAAATCAGCAAAAGCA 1089

Query:   492 CTGACTGCTCCAAGTACCTCACNNNNNNNCTCT 524
             |  |||||  || |||  ||         ||||
Sbjct:  1090 CCAACTGCAACAGGTATGTCGTAATCTCTCTCT 1122

 

gb|U22105|BNU22105 Brassica napus germination-specific lipid transfer
            protein 1 mRNA,  complete cds
            Length = 580

  Plus Strand HSPs:

 Score = 276 (76.3 bits), Expect = 1.1e-12, P = 1.1e-12
 Identities = 116/192 (60%), Positives = 116/192 (60%), Strand = Plus / Plus

Query:   312 GACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTC 371
             || | || |||  ||||||||    |||    ||    ||  | || ||    || ||||
Sbjct:   164 GAGGGTGCTGCACTGGCGTTACTAATCTAAACAACATGGCCCGTACAACCCCGGACCGTC 223

Query:   372 AAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCA 431
             |    || |||  ||||||   |  ||| ||    ||  |  ||    ||||    | | 
Sbjct:   224 AGCAAGCTTGCCGTTGCCTTGTAGGAGCCGCTAACGCCTTCCCTACTCTCAACGCTGCCC 283

Query:   432 AAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCA 491
               |||||||| || ||||   | ||||| ||||||||||||||||| ||||||     ||
Sbjct:   284 GTGCTGCTGGACTTCCTAAGGCATGTGGAGTCAATATTCCTTACAAAATCAGCAAAAGCA 343

Query:   492 CTGACTGCTCCA 503
             |  |||||  ||
Sbjct:   344 CCAACTGCAACA 355

 

emb|Z31588|GHLITRPR G.hybrida (Regina) mRNA for lipid transfer protein
            Length = 567

  Plus Strand HSPs:

 Score = 261 (72.1 bits), Expect = 2.0e-11, P = 2.0e-11
 Identities = 113/189 (59%), Positives = 113/189 (59%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             ||||||  ||| |||  ||  ||    ||  ||||||  || ||   ||| ||||| |  
Sbjct:   174 TGTTGCAATGGAGTTCGGGGACTTAATAACGCTGCAAAAACTACCCCAGACCGTCAGACA 233

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || ||   |||||| |||     |  ||  || |   |  | || ||  |    || || 
Sbjct:   234 GCTTGTGGTTGCCTAAAAGGTATTTTAGCAGCCAACACCCGCATAAACCTTAATAATGCC 293

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
                 | |||||  | |  |||||| | |  ||   |||||||||||  |||  ||  |||
Sbjct:   294 AACAGCCTCCCAGGCAAGTGTGGTATTAGCATCGGTTACAAGATCACGCCTAACATAGAC 353

Query:   497 TGCTCCAAG 505
             |||||||||
Sbjct:   354 TGCTCCAAG 362

 

gb|U72765|PVU72765 Phaseolus vulgaris non-specific lipid transfer
            protein PvLTP-24 (Pvltp-24) mRNA, complete cds
            Length = 617

  Plus Strand HSPs:

 Score = 260 (71.8 bits), Expect = 2.5e-11, P = 2.5e-11
 Identities = 84/124 (67%), Positives = 84/124 (67%), Strand = Plus / Plus

Query:   380 TGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCT 439
             ||||  ||||||||||| || || ||||| ||  ||||| |||||     ||| || |  
Sbjct:   292 TGCAACTGCCTGAAATCCGCCGCCGGTGCCATCCCTGGATTCAATGCTAACAACGCAGGC 351

Query:   440 GGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGC 499
                |||||  | |  ||||| ||||  || |  ||||| |||||  | |||||  |||||
Sbjct:   352 ATACTCCCGGGCAAGTGTGGCGTCAGCATCCACTACAACATCAGTACCTCCACCAACTGC 411

Query:   500 TCCA 503
              | |
Sbjct:   412 GCTA 415

 

gb|U22174|BNU22174 Brassica napus germination-specific lipid transfer
            protein 2 mRNA, complete cds.
            Length = 622

  Plus Strand HSPs:

 Score = 258 (71.3 bits), Expect = 3.6e-11, P = 3.6e-11
 Identities = 114/192 (59%), Positives = 114/192 (59%), Strand = Plus / Plus

Query:   312 GACGTTGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTC 371
             || | || |||   |||||||    |||    ||    ||  | || ||    || ||||
Sbjct:   210 GAGGGTGCTGCACCGGCGTTACTAATCTAAACAACATGGCCCGTACAACCCCGGACCGTC 269

Query:   372 AAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCA 431
             |    || |||  ||| ||   |  ||| ||     |  |  ||    ||||    | | 
Sbjct:   270 AGCAAGCTTGCCGTTGTCTTGTAGGAGCCGCTAACTCCTTCCCTACTCTCAACGCTGCCC 329

Query:   432 AAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCA 491
              ||||||||| || ||||   | ||||| ||||||||||||||||| ||||||     ||
Sbjct:   330 GAGCTGCTGGACTTCCTAAGGCATGTGGAGTCAATATTCCTTACAAAATCAGCAAAAGCA 389

Query:   492 CTGACTGCTCCA 503
             |  |||||  ||
Sbjct:   390 CCAACTGCAACA 401

 

gb|U64874|GHU64874 Gossypium hirsutum lipid transfer protein (ltp6)
            gene, complete cds
            Length = 1700

  Plus Strand HSPs:

 Score = 250 (69.1 bits), Expect = 1.7e-10, P = 1.7e-10
 Identities = 110/185 (59%), Positives = 110/185 (59%), Strand = Plus / Plus

Query:   326 GGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATTGCATGCACT 385
             ||| | |   ||||      | | ||  | |  | |  |||||| |||   || || |  
Sbjct:   622 GGCATCAGATCTCTCAAATCTGCCGCCCGAATAAGACTAGATCGGCAAGCAGCTTGTAAA 681

Query:   386 TGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCTGCTGGTCTC 445
             ||| | |||      || |  |  |||||||  ||||| |  |||   || || || |||
Sbjct:   682 TGCATCAAAAGTCTGGCCGCCGACATTTCTGACATCAACTATGGCGTTGCAGCCGGACTC 741

Query:   446 CCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGCTCCAAG 505
             ||  |    ||    ||| | || ||||||||||||||||||  || |||||||   | |
Sbjct:   742 CCAGGCCAGTGCAACGTCCACATCCCTTACAAGATCAGCCCTAGCATTGACTGCAAAAGG 801

Query:   506 TACCT 510
             | | |
Sbjct:   802 TTCGT 806

 

gb|M80567|ATHSEQB A.thaliana non-specific lipid transfer protein (LTP1)
            gene, partial cds.
            Length = 1964

  Plus Strand HSPs:

 Score = 227 (62.7 bits), Expect = 1.4e-08, P = 1.4e-08
 Identities = 74/115 (64%), Positives = 74/115 (64%), Strand = Plus / Plus

Query:   413 TCTGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCT 472
             |||||  ||||    |||   || |||||  | ||||   | ||||| ||||||||||||
Sbjct:  1484 TCTGGTCTCAACGCTGGCCGTGCAGCTGGAATTCCTAAGGCATGTGGAGTCAATATTCCT 1543

Query:   473 TACAAGATCAGCCCTTCCACTGACTGCTCCAAGTACCTCACNNNNNNNCTCTCTC 527
             ||||| |||||| |   |||  |||||   | |||  | |        | |||||
Sbjct:  1544 TACAAAATCAGCACCAGCACCAACTGCAAAACGTATGTTAATCTCTCTCACTCTC 1598

 

emb|X96716|PALTP3 P.amygdalus mRNA for lipid transfer protein III
            Length = 694

  Plus Strand HSPs:

 Score = 222 (61.3 bits), Expect = 3.6e-08, P = 3.6e-08
 Identities = 54/66 (81%), Positives = 54/66 (81%), Strand = Plus / Plus

Query:   434 GCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACT 493
             || ||||| || ||| | |  ||||| |||||||||||||||||||||   ||||| |||
Sbjct:   366 GCGGCTGGCCTTCCTGGCAAGTGTGGGGTCAATATTCCTTACAAGATCTCTCCTTCTACT 425

Query:   494 GACTGC 499
             ||||||
Sbjct:   426 GACTGC 431

 

gb|AF017358|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
            Length = 695

  Plus Strand HSPs:

 Score = 215 (59.4 bits), Expect = 1.4e-07, P = 1.4e-07
 Identities = 107/187 (57%), Positives = 107/187 (57%), Strand = Plus / Plus

Query:   317 TGTTGCGGTGGCGTTAAGGCTCTGGTGAATTCTGCAAGGACCACAGAAGATCGTCAAATT 376
             || ||| | ||||| | |   ||        | || |  ||||| |  || || |  |  
Sbjct:   153 TGCTGCAGCGGCGTCAGGAACCTCAACTCCGCCGCCACCACCACCGCCGACCGCCGCACC 212

Query:   377 GCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTCTGGAATCAATTTGGGCAAAGCT 436
             || ||||  ||||| ||    |  || ||    ||    ||  | ||    ||||| || 
Sbjct:   213 GCCTGCAACTGCCTCAAGAACGTGGCCGGCAGCATCAGCGGCCTAAACGCCGGCAATGCC 272

Query:   437 GCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGAC 496
             ||  |  ||||    |  || || ||||  || || ||||  |||||||||||     ||
Sbjct:   273 GCCAGCATCCCCTCCAAGTGCGGCGTCAGCATCCCCTACACCATCAGCCCTTCTGTGTAC 332

Query:   497 TGCTCCA 503
             |||||||
Sbjct:   333 TGCTCCA 339

 

gb|L31938|BRRBIF38 Brassica rapa (bif38) mRNA, complete cds.
            Length = 628

  Plus Strand HSPs:

 Score = 191 (52.8 bits), Expect = 1.3e-05, P = 1.3e-05
 Identities = 75/121 (61%), Positives = 75/121 (61%), Strand = Plus / Plus

Query:   355 GACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTC 414
             |||||||  |||||| | |   | |||    ||||| |||||||| |     |  |||  
Sbjct:   197 GACCACACCAGATCGCCGACAAGTATGTGAGTGCCTTAAATCAGCCGGTAAGGAAATTAA 256

Query:   415 TGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTA 474
              ||  ||||| | | |   |  || |  |||||||  |||||||||||     || | ||
Sbjct:   257 AGGCCTCAATATCGACCTTGTGGCCGCACTCCCTACCACTTGTGGTGTTTCACTTTCCTA 316

Query:   475 C 475
             |
Sbjct:   317 C 317

 

emb|X60318|BNE2 B.napus mRNA, homologous to phospholipid transfer
            proteins and amylase/protease inhibitors.
            Length = 658

  Plus Strand HSPs:

 Score = 191 (52.8 bits), Expect = 1.3e-05, P = 1.3e-05
 Identities = 75/121 (61%), Positives = 75/121 (61%), Strand = Plus / Plus

Query:   355 GACCACAGAAGATCGTCAAATTGCATGCACTTGCCTGAAATCAGCTGCAGGTGCTATTTC 414
             |||||||  |||||| | |   | |||    ||||| |||||||| |     |  |||  
Sbjct:   240 GACCACACCAGATCGCCGACAAGTATGTGAGTGCCTTAAATCAGCCGGTAAGGAAATTAA 299

Query:   415 TGGAATCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTA 474
              ||  ||||| | | |   |  || |  |||||||  |||||||||||     || | ||
Sbjct:   300 AGGCCTCAATATCGACCTTGTGGCCGCACTCCCTACCACTTGTGGTGTTTCACTTTCATA 359

Query:   475 C 475
             |
Sbjct:   360 C 360

 

gb|U29176|OSU29176 Oryza sativa lipid transfer protein precursor, mRNA,
            partial cds.
            Length = 466

  Plus Strand HSPs:

 Score = 160 (44.2 bits), Expect = 0.0051, P = 0.0051
 Identities = 56/86 (65%), Positives = 56/86 (65%), Strand = Plus / Plus

Query:   420 TCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGA 479
             ||||  ||||||| || ||     |||| || |  ||||| |||    |  | | |   |
Sbjct:   208 TCAACATGGGCAACGCCGCCTCCATCCCCAGCAAATGTGGCGTCTCCGTCGCCTTCCCCA 267

Query:   480 TCAGCCCTTCCACTGACTGCTCCAAG 505
             ||||| | |||   ||||||||||||
Sbjct:   268 TCAGCACCTCCGTCGACTGCTCCAAG 293

 

dbj|D10955|RIC323PTP Rice mRNA for Phospholipid transfer protein
            Length = 372

  Plus Strand HSPs:

 Score = 159 (43.9 bits), Expect = 0.0062, P = 0.0062
 Identities = 47/66 (71%), Positives = 47/66 (71%), Strand = Plus / Plus

Query:   440 GGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCTTCCACTGACTGC 499
             ||  ||||    |  || |  ||||| || || |||   |||||||||||||| ||||||
Sbjct:    80 GGCATCCCCTCCAAGTGCGACGTCAACATCCCCTACGGCATCAGCCCTTCCACCGACTGC 139

Query:   500 TCCAAG 505
             |||| |
Sbjct:   140 TCCAGG 145

 

emb|Z31590|CER01H10 Caenorhabditis elegans cosmid R01H10, complete
            sequence [Caenorhabditis elegans]
            Length = 31,543

  Minus Strand HSPs:

 Score = 158 (43.7 bits), Expect = 0.0075, P = 0.0075
 Identities = 46/64 (71%), Positives = 46/64 (71%), Strand = Minus / Plus

Query:    595 ATTCCGAATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATAAGGATAAG 536
              |||  |||| ||||||||||||  | ||| |   ||||||||| | | || ||  || ||
Sbjct:  21462 ATTTTGAATGAAAAATTTAAAAATTCAGCAACTTTGAAGCAGAAAAATTAGAAAAATCAG 21521

Query:    535 AATA 532
              || |
Sbjct:  21522 AAAA 21525

 

emb|X83433|OSLTPB21 O.sativa mRNA for lipid transfer protein, b21
            Length = 509

  Plus Strand HSPs:

 Score = 142 (39.2 bits), Expect = 0.16, P = 0.15
 Identities = 54/86 (62%), Positives = 54/86 (62%), Strand = Plus / Plus

Query:   420 TCAATTTGGGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGA 479
             ||||  ||||||| || ||     |||| || |  || |  |||     ||  | |   |
Sbjct:   194 TCAACATGGGCAACGCCGCCTCCATCCCCAGCAAATGCGCCGTCTCCGATCGCTTCCCCA 253

Query:   480 TCAGCCCTTCCACTGACTGCTCCAAG 505
             ||||| | |||   ||||||||||||
Sbjct:   254 TCAGCACCTCCGTCGACTGCTCCAAG 279

 

emb|Z37114|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer
            protein precursor.
            Length = 627

  Plus Strand HSPs:

 Score = 141 (39.0 bits), Expect = 0.19, P = 0.18
 Identities = 53/84 (63%), Positives = 53/84 (63%), Strand = Plus / Plus

Query:   428 GGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCT 487
             ||||  || || ||  ||||    |  || || ||||   | || |||| ||||||| | 
Sbjct:   264 GGCAGGGCCGCAGGCATCCCCTCCAGGTGCGGCGTCAGCGTCCCCTACACGATCAGCGCC 323

Query:   488 TCCACTGACTGCTCCAAGTACCTC 511
                   ||||||||||||  || |
Sbjct:   324 AGTGTCGACTGCTCCAAGATCCAC 347

 

emb|X68655|HVCW18 H.vulgare Cw-18 mRNA
            Length = 732

  Plus Strand HSPs:

 Score = 132 (36.5 bits), Expect = 1.1, P = 0.66
 Identities = 52/84 (61%), Positives = 52/84 (61%), Strand = Plus / Plus

Query:   428 GGCAAAGCTGCTGGTCTCCCTAGTACTTGTGGTGTCAATATTCCTTACAAGATCAGCCCT 487
             || |  || || ||  ||||    |  || || ||||   | || |||| ||||||| | 
Sbjct:   335 GGAAGGGCCGCAGGCATCCCCTCCAGGTGCGGGGTCAGCGTCCCCTACACGATCAGCGCC 394

Query:   488 TCCACTGACTGCTCCAAGTACCTC 511
                   ||||||||||||  || |
Sbjct:   395 AGTGTCGACTGCTCCAAGATCCAC 418

 

gb|AC002542|AC002542 Human BAC clone RG114A06 from 7q31, complete
            sequence [Homo sapiens]
            Length = 188,741

  Plus Strand HSPs:

 Score = 130 (35.9 bits), Expect = 1.6, P = 0.80
 Identities = 50/80 (62%), Positives = 50/80 (62%), Strand = Plus / Plus

Query:     165 AAACAATGGAAATAGCTGGGAAAATTGCATGCTTTGTGGTATTGTGCATGGTGGTAGCTG 224
               ||||||||||||  | ||  |  |  |  ||  | |||  |||  | | ||||||||   
Sbjct:  128263 AAACAATGGAAAATGGTGATATGAGGGGGTGGGTGGTGACATTAGGTAGGGTGGTAGAGA 128322

Query:     225 CACCCTGCGCAGAAGCCATA 244
                |   || | ||| ||||||
Sbjct:  128323 GAGTTTGAGAAGATGCCATA 128342

 

gb|U67505|MJU67505 Methanococcus jannaschii from bases 492477 to 504819
            (section 47 of 150) of the complete genome
            Length = 12,343

  Minus Strand HSPs:

 Score = 130 (35.9 bits), Expect = 1.6, P = 0.80
 Identities = 54/89 (60%), Positives = 54/89 (60%), Strand = Minus / Plus

Query:   112 GGGAAGATATAATAAATGCTTTAGGGAGTAGGAGCTAGTGTTGGATATAGAACACTATAG 53
             || |||  |  | || | || ||   | || |    | | |||||| || ||   || | 
Sbjct:  8814 GGTAAGTAAATAAAATTTCTCTAACAAATAAGTTAAATTTTTGGATTTAAAAAGATAAAA 8873

Query:    52 GACCTTAGGGTTTTTATAGGGAGAAAATT 24
                || ||  || ||| ||||||||||||
Sbjct:  8874 ATGCTCAGTTTTATTAAAGGGAGAAAATT 8902

 

emb|X64346|HSGEND Herpesvirus saimiri complete genome DNA
            Length = 112,930

  Minus Strand HSPs:

 Score = 128 (35.4 bits), Expect = 2.3, P = 0.90
 Identities = 36/49 (73%), Positives = 36/49 (73%), Strand = Minus / Plus

Query:    588 ATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATAAGGA 540
              |||||||||||||   ||   | ||||| ||||||  || |||| || |
Sbjct:  17459 ATAAAAAATTTAATCTATTCTCAAAAATTAAGCAGTGAGCATATTAGCA 17507

 

gb|M31122|HSVSPOLGBP Herpesvirus saimiri major DNA binding protein,
            glycoprotein B and DNA polymerase and other genes, complete cds.
            Length = 16,325

  Minus Strand HSPs:

 Score = 128 (35.4 bits), Expect = 2.3, P = 0.90
 Identities = 36/49 (73%), Positives = 36/49 (73%), Strand = Minus / Plus

Query:   588 ATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATAAGGA 540
             |||||||||||||   ||   | ||||| ||||||  || |||| || |
Sbjct:  5958 ATAAAAAATTTAATCTATTCTCAAAAATTAAGCAGTGAGCATATTAGCA 6006

 

gb|L40608|PFAVAR1A Plasmodium falciparum (strain Dd2) variant-specific
            surface protein (var-1) gene, complete cds.
            Length = 19,124

  Minus Strand HSPs:

 Score = 127 (35.1 bits), Expect = 2.8, P = 0.94
 Identities = 43/65 (66%), Positives = 43/65 (66%), Strand = Minus / Plus

Query:    590 GAATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATAAGGATAAGAATAG 531
              |||||||||||  ||||||| | | ||||  ||  | | | ||  |    |||| || | 
Sbjct:  15570 GAATAAAAAATGAAAAAGATTATCAAAAAAAAATTAAAAAAAAATTTTATATAAAAAAAA 15629

Query:    530 CATGA 526
               ||||
Sbjct:  15630 AATGA 15634

 

emb|Z81558|CEF59D12 Caenorhabditis elegans cosmid F59D12, complete
            sequence [Caenorhabditis elegans]
            Length = 36,494

  Plus Strand HSPs:

 Score = 125 (34.5 bits), Expect = 4.2, P = 0.98
 Identities = 41/61 (67%), Positives = 41/61 (67%), Strand = Plus / Plus

Query:    121 ATACTTCATTCCACAAATAGTTTGCAGCTTTTTCTTTTCCTCTAAAACAATGGAAATAGC 180
              |||   | ||  | |||| ||||  |  || ||  ||| || | ||| | ||||||||||
Sbjct:  26624 ATAAAACTTTTGAAAAATTGTTTTTAATTTGTTTATTTACTGTCAAAAAGTGGAAATAGC 26683

Query:    181 T 181
              |
Sbjct:  26684 T 26684

 

gb|U67570|MJU67570 Methanococcus jannaschii from bases 1238533 to
            1248811 (section 112 of 150) of the complete genome
            Length = 10,279

  Plus Strand HSPs:

 Score = 126 (34.8 bits), Expect = 4.6, Sum P(2) = 0.99
 Identities = 38/54 (70%), Positives = 38/54 (70%), Strand = Plus / Plus

Query:    89 CTAAAGCATTTATTATATCTTCCCCTAGCTAGATACTTCATTCCACAAATAGTT 142
             ||||||||||| ||| ||||||   ||| || |||  |   ||   ||||| ||
Sbjct:  4226 CTAAAGCATTTTTTACATCTTCTGGTAGATAAATAGCTGCCTCTCTAAATAATT 4279

 Score = 80 (22.1 bits), Expect = 4.6, Sum P(2) = 0.99
 Identities = 24/34 (70%), Positives = 24/34 (70%), Strand = Plus / Plus

Query:   149 TTTTTCTTTTCCTCTAAAACAATGGAAATAGCTG 182
             ||| | |||      ||||| ||||||||||| |
Sbjct:  7753 TTTATTTTTAAAGAAAAAACCATGGAAATAGCAG 7786

 

gb|L48605|C2PVCG Bacteriophage c2 complete genome.
            Length = 22,172

  Plus Strand HSPs:

 Score = 124 (34.3 bits), Expect = 5.0, P = 0.99
 Identities = 44/68 (64%), Positives = 44/68 (64%), Strand = Plus / Plus

Query:    533 ATTCTTATCCTTATATTCTATCTGCTTCATTTTCGCTTATCTTTTAAATTTTTTATTCGG 592
              |||  ||   || | |  | | |  || |||||   |||| ||||  ||||||||||| |
Sbjct:  22062 ATTAATAAATTTTTTTGATTTGTTATTTATTTTATATTATTTTTTTTATTTTTTATTCCG 22121

Query:    593 AATCTTTA 600
              | |  |||
Sbjct:  22122 AGTTCTTA 22129

 

gb|L37091|C2PORF Bacteriophage c2 (from Lactococcus lactis) gene,
            terminal region.
            Length = 2306

  Plus Strand HSPs:

 Score = 124 (34.3 bits), Expect = 5.0, P = 0.99
 Identities = 44/68 (64%), Positives = 44/68 (64%), Strand = Plus / Plus

Query:   533 ATTCTTATCCTTATATTCTATCTGCTTCATTTTCGCTTATCTTTTAAATTTTTTATTCGG 592
             |||  ||   || | |  | | |  || |||||   |||| ||||  ||||||||||| |
Sbjct:  1566 ATTAATAAATTTTTTTGATTTGTTATTTATTTTATATTATTTTTTTTATTTTTTATTCCG 1625

Query:   593 AATCTTTA 600
             | |  |||
Sbjct:  1626 AGTTCTTA 1633

 

emb|Z82278|CEM162 Caenorhabditis elegans cosmid M162, complete sequence
            [Caenorhabditis elegans]
            Length = 39,977

  Plus Strand HSPs:

 Score = 124 (34.3 bits), Expect = 5.0, P = 0.99
 Identities = 28/32 (87%), Positives = 28/32 (87%), Strand = Plus / Plus

Query:    571 ATCTTTTAAATTTTTTATTCGGAATCTTTATA 602
              |||||||||||||||||||  | || ||||||
Sbjct:  12246 ATCTTTTAAATTTTTTATTGAGTATTTTTATA 12277

 

emb|Z34517|LBC2COSS Lactococcal bacteriophage c2 DNA cos site, repeat region
            Length = 316

  Minus Strand HSPs:

 Score = 124 (34.3 bits), Expect = 5.0, P = 0.99
 Identities = 44/68 (64%), Positives = 44/68 (64%), Strand = Minus / Plus

Query:   600 TAAAGATTCCGAATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATAAGG 541
             |||  | || |||||||||||  |||| ||||   ||||| ||  | | |  | | ||  
Sbjct:   145 TAAGAACTCGGAATAAAAAATAAAAAAAATAATATAAAATAAATAACAAATCAAAAAAAT 204

Query:   540 ATAAGAAT 533
              ||  |||
Sbjct:   205 TTATTAAT 212

 

gb|AC000065|HSAC000065 Human BAC clone RG085C05 from 7q21-7q22; HTGS
            phase 3, complete sequence [Homo sapiens]
            Length = 82,261

  Minus Strand HSPs:

 Score = 128 (35.4 bits), Expect = 5.3, Sum P(2) = 0.99
 Identities = 40/58 (68%), Positives = 40/58 (68%), Strand = Minus / Plus

Query:    601 ATAAAGATTCCGAATAAAAAATTTAAAAGATAAGCGAAAATGAAGCAGATAGAATATA 544
              | ||| |||   ||||||||||||||||  |||  ||  ||   |   ||| ||||||
Sbjct:  25810 ACAAAAATTAAAAATAAAAAATTTAAAAAGTAACAGATTATCTTGATTATAAAATATA 25867

 Score = 87 (24.0 bits), Expect = 5.3, Sum P(2) = 0.99
 Identities = 27/39 (69%), Positives = 27/39 (69%), Strand = Minus / Plus

Query:    206 ATACCACAAAGCATGCAATTTTCCCAGCTATTTCCATTG 168
              |||||||||||||    | ||| ||  ||| ||   |||
Sbjct:  42894 ATACCACAAAGCAATTCACTTTACCTTCTAGTTGGGTTG 42932


Parameters:

  V=100
  B=50
  H=0

  Lambda     K      H
     0.192   0.173   0.357

  E     S     T     X
  10.0     122      0      73

  Database:  Non-redundant GenBank+EMBL+DDBJ+PDB sequences
    Posted date:  Dec 5, 1997  7:09 AM
  # of letters in database:  581,488,900
  # of sequences in database:  312,067

  Number of Hits to DB: 225310
  Number of Sequences: 312067
  Number of extensions: 225310
  Number of successful extensions: 6877
  Number of sequences better than 10: 51