* David Liu, same guy from last homework, he also isolated a cDNA clone from
snake venom library. The nucleotide sequence of this cDNA clone is shown
here:
AAAACCATCAAATACGTTATGCTGGAATGCAACGAACTGATCCCGCTGTTCTACGAAACCT
GCCCGGCTGGTGAAAACATCTGCTACGAAATGTTCATGGTTGCTACCCCGAAAGTTCCGTGC
GAACGTGGTTGCATCGACGTTTGCCCGGAATCTTCTCTGATCGTTAAATACGTTTGCTGCAA
CACCGACCGTTGCCAGTAATCCAGCGCCTGATCTCTCGAAATAAAAGCCGCATTG
(1) Please help him to analyze the cutting patterns of following restriction
enzyme:
EcoRI, Sau3AI, HinfI and MseI.
View Answer (1)
(2) Please help him to find its corresponding polypeptide sequence.
View Answer (2)
(3) Please help him to identify this toxin. Is it a new toxin?
View Answer (3)
(4) David would like to see its structure. Could you help him to find
structure of this toxin or make a model if it is a new protein? Show
structure on your homwpage ( 3 different views).
View Answer (4)
Back to Questions
- EcoR| has no function.
- HinfI G'AnT_C - 1 Cut(s) 152 HinfI ------------------------------------------------------------------------------------------\-----------------------------------------------------
- MseI T'TA_A - 1 Cut(s) 168 MseI ----------------------------------------------------------------------------------------------------\-------------------------------------------
- Sau3AI 'GATC_ - 3 Cut(s) 39 162 215 Sau3AI ----------------------\-------------------------------------------------------------------------\-------------------------------\---------------
Restriction Map of Sequence AlwI AciI CviRI Sau3AI Pfl1108I BccI MaeII BsmI DpnI FauI \ \ \ \ \ \ \ \ \ \ \ 1 aaaaccatcaaatacgttatgctggaatgcaacgaactgatcccgctgttctacgaaacc 60 ttttggtagtttatgcaatacgaccttacgttgcttgactagggcgacaagatgctttgg ^ * ^ * ^ * ^ * ^ * ^ * K T I K Y V M L E C N E L I P L F Y E T MboII TfiI MspI MaeII ScrFI MseI TaqI NciI Sau3AI TseI MaeII CviRI SfaNIHinfI DpnI MaeII Fnu4HI \ \ \ \ \ \ \ \ \ \ \ \ \ \\ 121 tgcgaacgtggttgcatcgacgtttgcccggaatcttctctgatcgttaaatacgtttgc 180 acgcttgcaccaacgtagctgcaaacgggccttagaagagactagcaatttatgcaaacg ^ * ^ * ^ * ^ * ^ * ^ * C E R G C I D V C P E S S L I V K Y V C Sau3AI AciI BsrI HhaI DpnI TauI BsbI Tsp4CI HaeII Fnu4HI CviRI BsiEI AlwNI TaqI CviJI \ \ \\ \ \\ \ \ \ \\ 181 tgcaacaccgaccgttgccagtaatccagcgcctgatctctcgaaataaaagccgcatt 240 acgttgtggctggcaacggtcattaggtcgcggactagagagctttattttcggcgtaa ^ * ^ * ^ * ^ * ^ * ^ * C N T D R C Q Z S S A Z S L E I K A A
(2) Please help him to find its corresponding polypeptide sequence.
The nucleotide sequences are translated by EBI and NCBI:
(3) Please help him to identify this toxin. Is it a new toxin?
From Blast results, the most similar protein is cardiotoxin (2CRT in PDB). The homology is only 84%. So the sequence encodes a new protein.
(4) David would like to see its structure. Could you help him to find
structure of this toxin or make a model if it is a new protein? Show
structure on your homwpage ( 3 different views).
The structures are from Swiss model.
| The pretein is colored by different structures. |
| The yellow bonds are hydrogen bonds. |
| The disulfide bonds are colored in red. Three disulfide bonds are cys9-cys16, cys37-cys48, and cys49-cys54. |
Mail to me:b821605@life.nthu.edu.tw