Homework 3
Tryptophan repressor

  1. The strcture of the apo-trp-repressor and its complex with its operator
    Apo Form
    display cartoons
    select *R
    color cyan
    select *S
    color red
    select 77
    spacefill
    color yellow
     
    
ID number : 1trp
Authors : D.Zhao, Z.Zheng
Resolution : Not applicable
Number of residues in one monomer :  107
Nuber of cofactors : none
    Trp Repressor With operator
    display cartoons
    select *A
    color cyan
    select *C
    color red
    select *E
    color green
    select *G
    color white
    select 77
    spacefill
    color yellow
    select *B,*D,*F,*H
    spacefill
    color blue
    
ID number : 1tro
Authors : Z.Otwinowski, R.G.Zhang, P.B.Sigler
Resolution : 1.9 Angstroms
Number of residues in one monomer :  108
Nuber of cofactors : 4

  2. The role of tryptophan intryptophan-repressor

    The binding of trp in trp-reoressior induces a conformational change and alters the oritation of reognition helices ( helix 3 and 5 of each monomer) . The binding of trp is wedged between the recognition helices. Before binding of trp, the width of the recognition helices is about 34 angstrom , too large for the recogntion helices to bind to the major groove of the operator DNA. But when trp are starvation, the distance between the two DNA binding sites of the repressor is shorted to 5-6 angstrom which allow them to fit into the major groove. By this way, the binding of trp-the allosteric efector confers the DNA-binding capacity on trp-repressor.
Arc Repressor
  1. The DNA sequences of the Arc operator are :

      5'TATAGTAGAGTGCTTCTATCAT 3'      3'TATCATCTCACGAAGATAGTAA 5'

  2. The hydrogen bonds between the Arc-repressor and its operator
    ID number : 1PAR
Author : B.E.Paumann,M.A.Rould,
          C.O.Pabo,R.T.Sauer
Resolution : 2.6  Angstroms
    The unit of the values of the hydrogen-bond showed bellow is Angstroms .
    wireframe off
    restrict gln9d,asn11d,arg13d,g4f,a7f,t17e
    display ball and sticks
    select gln9
    color yellow
    select asn11d
    color [255,105,255]
    select arg13d
    color red
Do you want to go back to the first page? Click it!