Raw output of the simPCR analysis of primers pair S

Output of the Findpatterns program and simPCR for analysis of one primers pair (described as S in the manuscript, and as lowe in the programs runs). Only minor modifications were introduced, including addition of remarks (italics), and deletion of some text (3 dots)

OUTPUT OF FINDPATTERNS:

 This is the summery lines of the Findpatterns output. Refer to GCG manual for more details.

FINDPATTERNS on @dbases.seqs allowing 5 mismatches




...	Some line deleted here


Total finds:	4,834	Number of finds found in the Genbank subsections used
Total length:	225,561,436	Total sequences length in bp
Total sequences:	160,900	
CPU time: 	1:09:16.37	CPU time on a Silicon Graphics workstation

OUTPUT OF simPCR:

This is the raw output of the simPCR program (also summarized in table 2 in the manuscript). Output contains three parts: a header , which includes some details on the search extracted from the Findpatterns file and the simPCR run parameters., a product report, which describes in detail all the products , and a summery, which gives some statistics.

The header is self-explanatory (we hope). The product report is a little more complex, as it compresses a large amount of information. For each products, the report include the following details:

1st line: entry description
entry title as reported by Findpatterns (extracted directly from Genbank)
Example11 ck: 1111 len: 9,999 ! X00001 O.cuniculus mRNA for etgX. 1/92

2nd line: product description.
The primers at the 5' and 3' ends of the product are described, and the product length is given. For each end of the product, the following is reported: the annealing site position within the Genbank entry, which primer annealed, with how many mismatches and in what orientation. 3' primer is described in reverse order.

3rd line etc.
If more than one product was obtained from the same Genbank entry, all other products are reported in the same format under one entry description line

          simpcr.out: result of file lowe1.hits               

search scope: @dbases.seqs allowing 5 mismatches

Primers used for this scan:
1 GTTGTGGGTCACATAACGC
2 AGAGTGTGTCTACTTCTGCC

*** search limits:
- both primers must have no more then 4 mismatches 
- size limit: fragment size must be more then 40bp and less then 4000bp


**************** Products report: ***************** ..

OCET1  ck: 1796  len: 1,639 ! X59931 O.cuniculus mRNA for endothelin-1. 1/92
296: 2(1)} <- 396 -> {1(4) :692

HSET  ck: 1088  len: 1,167 ! Y00749 Human mRNA for endothelin. 3/95
435: 2(0)} <- 423 -> {1(0) :858

HSP450P2  ck: 3153  len: 2,130 ! X16699 Human mRNA for cytochrome P-450HP. 9/93
547: 1(3)} <- 371 -> {2(4) :918

HUMCP45IV  ck: 444   len: 2,084 ! J02871 Human lung cytochrome P450 (IV subfamily) BI protein, complete cds.
559: 1(3)} <- 371 -> {2(4) :930

HUMEDN1B  ck: 351   len: 12,461 ! J05008 Homo sapiens endothelin-1 (EDN1) gene, complete cds. 11/94
5703: 2(0)} <- 3581 -> {1(0) :9284

S56805  ck: 4878  len: 1,251 ! S56805 preproendothelin 1 {alternatively transcribed} [human, placenta, mR
519: 2(0)} <- 423 -> {1(0) :942

**************** Results End *************** ..

=== Search statistics: ===

Sequences containing at least one primer: 504
Total finds:          529
Total simPCR fragments: 		    6
ÿ