HOMEWORK#3

Viewing Proteins / PDB


1. Find the structure of prion from PDB.

(A) List the following information : (1) ID number, (2) Authors, (3) The number of residues in one monomer, (4) The number of disulfide bonds.

Ans. The ID number of prion molicule is 1AG2, whose authers are M.Billeter, R.Riek, G.Wider, K.Wuthrich, S.Hornemann, and R.Glockshuber. Each monomer consists of residues, and has only one disulfide bond in the molecule.

(B) Put the structure of prion on your homepages. Show different color for different secondary structure in cartoon form with sidechains on (helix in blue, sheets in red). Show the script that makes the final picture.

 

This is the script of the picture above.

2. Transcription of the ant gene during lytic growth of bacteriophage P22 is regulated by the cooperative binding of two Arc repressor dimers to a 21-base-pair operator site. Please find the co-crystal structure of this Arc tetramer-operator complex from PDB.

(a) Make an animation (by Gifbuilder) of whole complex.

(b) Show the DNA sequences of the Arc operator.

TATAGTAGAGTGCTTCTATCAT

TATCATCTCACGAAGATAGTAA

(c) The picture below is the hydrogen bonds between beta-sheet side chains and DNA bases. Show three side chains (gln9, asn11, arg13) from one monomer and corresponding DNA bases of them on your home page. Color three side chain with different color. Measure the distance between possible hydrogen bonds.

 

Ø