AAAACCATCAAATATGTTATGCTGGAATGCAACGAACTGATCCCGCTGTTC
TACGAAACCTGCCCGGCTGGTGAAAACATCTGCTACGAAATGTTCATGGTT
GCTACCCCGAAAGTTCCGTGCGAACGTGGTTGCATCGACGTTTGCCCGGAA
TCTTCTCTGATCGTTAAATACGTTTGCTGCAACACCGACCGTTGCCAGTAAT
CCAGCGCCTGATCTCTCGAAATAAAAGCCGCATTG
(1) Please help him to find its corresponding polypeptide sequence
(DNA -> Protein translation).
(2) Please help him to calculate pI/Mw of this polypeptide, perform the trypsin cutting , analyze the cutting pattern and report the fragments with MW over 500 Dalton.
(3) Please help him to identify this toxin. Is it a new toxin?
Inditities=48/59=81% ---> new toxin
(4) Please help him to use Prosite scanning tool to find out possible functions or pattern.
(5) David would like to see its structure. Could you help him to find structure of this toxin or make a model if it is a new protein? Show structure on your homwpage ( 3 different views).