• David Liu, same guy from last homework, he also isolated a cDNA clone from snake venom library. The nucleotide sequence of this cDNA clone is shown here:

    AAAACCATCAAATACGTTATGCTGGAATGCAACGAACTGATCCCGCTGTTCTACGAAACCT

    GCCCGGCTGGTGAAAACATCTGCTACGAAATGTTCATGGTTGCTACCCCGAAAGTTCCGTGC

    GAACGTGGTTGCATCGACGTTTGCCCGGAATCTTCTCTGATCGTTAAATACGTTTGCTGCAA

    CACCGACCGTTGCCAGTAATCCAGCGCCTGATCTCTCGAAATAAAAGCCGCATTG

    (1) Please help him to analyze the cutting patterns of following restriction enzyme:

    (2) Please help him to find its corresponding polypeptide sequence.

    (3) Please help him to identify this toxin. Is it a new toxin?

    (4) David would like to see its structure. Could you help him to find structure of this toxin or make a model if it is a new protein? Show structure on your homwpage ( 3 different views).