HOMEWORK#8

Sequence analysis / model building

• due on 5/28/98

• David Liu, a student in the department of Lfe Sciences, got a clone from E coli. Here is the DNA sequence:

TGGATGCCATGTTCCGGAGGTAATATGAAGAAATCAATATTATTTATTTTTCTTT

CTGTATTGTCTTTTTCACCTTTCGCTCAGGATGCTAAACCAGTAGAGTCTTCAAA

AGAAAAAATCACACTAGAATCAAAAAAATGTAACATTGCAAAAAAAAGTAATA

AAAGTGGTCCTGAAAGCATGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTA

ATCCTGCTTGTACCGGGTGCTATTAATAATATAAAGGGAACTAAACAGTTCCCT

TTATATTTGTTCTGATTCTGATGATGTCTGTAACGTATGTCCTGTTGCTTTGTTG

AATAAATCGA

Unfortunately, he doesn't know how to use the sequence analysis tools availabled in the internet since he did not take Bioinformatics course before. Could you help him to do the following analysis?

• (1) Find its corresponding polypeptide sequence (DNA -> Protein translation).
• (2) Identify this protein. Is it a new protein?
• (3) Report the total number of negatively charged residues and positively charged residues.
• (4) Color the protein by its charge.
• (5) Draw the hydrophobicity map for this protein using Eisenberg hydrophobicity scale with window size 7. The relative weight of the window edges compared to the window center should set to 40%.
• (6) Please help him to use Prosite scanning tool to find out possible functions or pattern of this protein.
• (7) Calculate its pI and molecular weight.

        Minus Strand HSPs:Score = 134 (37.0 bits), Expect = 0.46, P = 0.37
         Identities = 30/34 (88%), Positives = 30/34 (88%), Strand = Minus / Plus
        Query:   278 AATATAAAGGGAACTGTTTAGTTCCCTTTATATT 245
        Sbjct:     245 AATATAAAGGGAACTAAACAGTTCCCTTTATATT 278

        Function:Toxin which activates the particulate from of guanylate cyclase and increases cyclic GMP levels
                         within the host intestinal epithelial cells.
        Disease: Both heat-stable and heat-labile enterotoxins are produced by pathogenic strains of E.coli and
                        effect the digestive tract of mammals.
 
                      SIGNAL        1     19       BY SIMILARITY.
                      PROPEP       20     53       BY SIMILARITY.
                      PEPTIDE      54     72       ENTEROTOXIN A4.
                      DISULFID     59     64       BY SIMILARITY.
                      DISULFID     60     68       BY SIMILARITY.
                      DISULFID     63     71      BY SIMILARITY
 
      M K K S I L F I F L S V L S F S P F A Q D A K P V E S S K E K I T L E S K K C N I A K K S N K S G P E S M
      N S S N YC C E L C C N P A C T G C Y
                        |_|____ |_|                |          |
                           |____ |________|           |
                                      |_____________|

 (3) Ans:
        Total number of negatively charged residues (Asp + Glu): 6
        Total number of positively charged residues (Arg + Lys): 10

   (4) Ans:
        negatively charged : D,E ( Red )
        positively charged: R,K ( Blue )
        Met K K S I L F I F L S V L S F S P F A Q D A K P V E S S K E K I T
        L E S K K C N I A K K  S N K S G P E S Met N S S N YC C E L C C N
        P A C T G C Y Stop

 (5) Ans:
                        Using the scale Hphob. / Eisenberg et al., the individual values for the 20 amino acids are:

Ala	Arg	Asn	Asp	Cys	Gln	Glu	Gly	His	Ile	Leu	Xaa
0.620	-2.530	-0.78	-0.900	0.290	-0.850	-0.740	0.480	-0.400	1.380	1.060	-0.000
Lys	Met	Phe	Pro	Ser	Thr	Trp	Tyr	Val	Asx	Glx
-1.500	0.640	1.190	0.120	-0.180	-0.050	0.810	0.260	1.080	-0.840	-0.795

 
Weights for window positions 1,..,7, using linear weight variation model:
 

1	2	3	4	5	6	7
0.40	0.60	0.80	1.00	0.80	0.60	0.40
edge			center			edge

 
 

 (6) Ans:

•  N-glycosylation site

• This pattern is found in most of the known physiological substrates.

It has been known for a long time that potential N-glycosylation sites are
specific to the consensus sequence Asn-Xaa-Ser/Thr.  It must be noted that the
presence of the consensus  tripeptide  is  not sufficient  to conclude that an
asparagine residue is glycosylated, due to  the fact that the  folding of  the
protein plays an important  role in the  regulation of N-glycosylation . It
has been shown that  the  presence of proline between Asn and Ser/Thr will
inhibit N-glycosylation; this  has  been confirmed by a recent statistical
analysis of glycosylation sites, which also  shows that about 50% of the sites
that have a proline C-terminal to Ser/Thr are not glycosylated.
It must also  be noted that there  are  a few  reported cases of glycosylation
sites with the pattern Asn-Xaa-Cys; an  experimentally demonstrated occurrence
of such a non-standard site is found in the plasma protein C .
-Consensus pattern: N-{P}-[ST]-{P}  (N is the glycosylation site)
• Number of matches: 2
              1: 46-49 NKSG
              2 : 54-57 NSSN
 
• Protein kinase C phosphorylation site

• In vivo, protein kinase C  exhibits  a  preference  for the phosphorylation of
             serine or  threonine residues found close to a C-terminal basic residue [1,2].
             The presence  of  additional   basic residues at the  N- or C-terminal of  the
             target amino acid enhances the Vmax and Km of the phosphorylation reaction.
             -Consensus pattern: [ST]-x-[RK]  (S or T is the phosphorylation site)
• Number of matches: 3
              1: 27-29 SSK
              2 : 36-38 SKK
              3 : 45-47 SNK
 
• Casein kinase II phosphorylation site

• Casein kinase II (CK-2) is a protein serine/threonine kinase whose activity is
             independent of  cyclic  nucleotides   and  calcium.  CK-2  phosphorylates many
            different proteins.   The  substrate  specificity [1]  of  this  enzyme can be
            summarized as follows:
            (1) Under comparable conditions Ser is favored over Thr.
            (2) An acidic residue (either Asp or Glu) must be present three residues from
                  the C-terminal of the phosphate acceptor site.
            (3) Additional acidic  residues in  positions +1, +2, +4, and +5 increase the
                  phosphorylation rate.  Most  physiological  substrates  have at least one
                  acidic residue in these positions.
            (4) Asp is preferred to Glu as the provider of acidic determinants.
            (5) A basic residue at the N-terminal  of the  acceptor  site  decreases  the
                 phosphorylation rate, while an acidic one will increase it.
                -Consensus pattern: [ST]-x(2)-[DE] (S or T is the phosphorylation site)
• Number of matches: 2
             1: 27-30 SSKE
             2: 48-51 SGPE
 
• Heat-stable enterotoxins signature

 
• Prokaryotic heat-stable  enterotoxins [1] are  responsible for acute diarrhea.
             The active toxin is  a short  peptide of around twenty residues which contains
six cysteines involved  in  three  disulfide  bonds, as shown in the following
schematic representation:
 xxCCxxCCxxxCxxCxx 
 'C': conserved cysteine involved in a disulfide bond.
We have  taken  the pattern of cysteines, along with three conserved residues,
as a signature pattern for this group of proteins.
-Consensus pattern: C-C-x(2)-C-C-x-P-A-C-x-G-C[The six C's are involved in disulfide bonds]

• 59-71 CCELCCNPACTGC