HOMEWORK 3
- Please find the genes for the protein that you showed the structures in homework 2.
Answer:
caaaagctcgtgccggaacccggcacgaatcatcatcaaccaattcgcaccgatcgatcg atcgatccagcaactagatcaacagtactagctaggaagcatggcccgtgcacagttggt gttggtcgccctggtggcagctctgctcctcgccgccccgcacgccgccgtggccatcac ctgcggccaggtcaactccgccgtcgggccctgcctgacctacgcccgcggcggcgccgg gccgtcggcggcctgctgcagcggcgtgaggagcctttttgctgcagcaagcacgaccgc agaccggcgcaccgcctgcaactgcctcaagaacgcggcccgcggcatcaaggggctcaa cgccggcaacgccgccagcatcccctccaagtgcggcgtcagcgtcccctacaccatcag cgcttccatcgattgctccagggtgagctgagccatcgatcagagacggatcatatatat acagcagcgcgccggttgccacctagtagattttgcctgggtcgatgtgtggagccgaat tatgtatccagtactagtagtatcatatctgtattctggaataaaagatgagctagctaa ggtttcgatcaatcaccatgcatccatggttgatcggcccggtcacgctagctagctttc ttcttcttgtgtgttcgtttcgtacgttttgctccttttcgaggggtacgtgtaccagag agagctagagattctacatgcatgtactgcaactccttgtactacgtgcttgttttggat tattacacataaaaaaaaa- Which organism do these genes come from? How many sequences of DNA and Protein have been known for this organism?
Answer: a. Oryza sativa (Rice) b. DNA sequence: 69340 c. protein: 2255- How many BLAST hits you can get if you use the gene you found for this protein as the query sequence to search against non-redundant GenBank + EMBL + DDBJ + PDB sequence database? Please also show 10 sequences that produce significant alignments ( you just need to show their names and ID numbers ).
Answer: I got 69 BLAST hits!
Name ID number O.sativa mRNA for lipid transfer protein Y08691 Oryza sativa lipid transfer protein LPT III mRNA AF017360 O.sativa mRNA for lipid transfer protein, a15 X83435 Oryza sativa lipid transfer protein LPT IV mRNA AF017361 Rice mRNA EN4 D29994 Oryza sativa lipid transfer protein precursor (LTP2) mRNA U31766 O.sativa mRNA for lipid transfer protein, b1 X83434 O.sativa lipid transfer protein gene Z23271 Oryza sativa lipid transfer protein mRNA AF017358 Rice mRNA for Phospholipid transfer protein D10955