HOMEWORK 4

---

Kevin Lyu, a graduate student in our department, got a cDNA that encode a protein from rice. Here is the sequence:

   CGGCACGAGCAGCAACTTAACTTGATCTTCGTGTGACCGATCGATGGCTC
   GCGCGGGACATAATAAGTATGTGGCGCGCGTGATGGTGGTGGCGCTGCTG
   TTGGCCGCGCGGGCACCCGTGACATGCGGGCAGGTGGTGAGCACTTGGGC
   GCCGTGCATCATGTACGCCGACGGGGAGGGTGTCGCCCCCACCGGCGGCT
   GCTGCGACGGGGTCAGGACCCTCAACTCCGCCGCCGCCACCACCGCCGAC
   CGCCAGACCACCTGCGCCTGCCTCAAGCAGCAGACCAAGGCCATGGGCCG
   GCTGAGGCCCGACCACGTCGCCGGCATCCCCTCCAAGTGCGGGGTCAACA
   TCCCCTACGCTATCAGCCCTTCCACCGACTGCTCCAGGGTGCACTGAGTG
   GATCAACGTCAAGTGATGCCACAATAATAATGGAGAGATGGATCCATCGA
   TCTGCGGCTCTCATTTTGCGGTTGCTATCTGCAATATTCGTCGTCGTCGG
   AGAGATCGAGCTAGAAATGCATGTTACTCCTCCGTTCTGTTACTATCTGC
   TTACCTGTTGCTTCGTGCGGTTTGATAGTGTCGTTATAGCTAGTGTAAGA
   GTGTGAGGGTTGATTTTGATCTGTCTCCTTTACGGGACGAGGGGCACGGC
   GAATCATGCATGAATCTTAGAGGACCTGCTTGCATTGTACCTTACTCAGT
   GCATGCTTCAATATATATCCATCAAATGAAGATCTTTTAATGAAAAAAAA
   AAAAAAAAAAAAAAAA

Unfortunately, he doesn't know how to use the sequence analysis tools availabled in the internet since he did not take Bioinformatics course before. Could you help him to do the following analysis?
• (1) Find its corresponding polypeptide sequence (DNA -> Protein translation).
  

  Answer:
  G T S S N L T Stop S S C D R S Met A R A G H N K Y V A R V Met V V A L L L A A R A P V T C G Q V V S T W A P C I Met Y A D G E G V A P T G G C C D G V R T L N S A A A T T A D R Q T T C A C L K Q Q T K A Met G R L R P D H V A G I P S K C G V N I P Y A I S P S T D C S R V H Stop V D Q R Q V Met P Q Stop Stop W R D G S I D L R L S F C G C Y L Q Y S S S S E R S S Stop K C Met L L L R S V T I C L P V A S C G L I V S L Stop L V Stop E C E G Stop F Stop S V S F T G R G A R R I Met H E S Stop R T C L H C T L L S A C F N I Y P S N E D L L Met K K K K K K K K

• (2) Identify this protein. Is it a new protein? If not, what's the name of this protein?
  

  Answer: It's not a new protein! Name:"Nonspecific Lipid-Transfer Protein"

• (3) Report the total number of negatively charged residues and positively charged residues.
  

  Answer: Total number of negatively charged residues (Asp + Glu): 16
  Total number of positively charged residues (Arg + Lys): 31

• (4) Draw the hydrophobicity map for this protein using Eisenberg hydrophobicity scale with window size 7. The relative weight of the window edges compared to the window center should set to 40%.

  Answer:
  

• (5) Is there any hydrophobic region in this protein? Can you explain the possible role for this region?
  

  Answer: Yes!! Hydrophobic region may be the transmembrane polypeptide chain crossing the lipid bilayer.

• (6) Please help him to use Prosite scanning tool to find out possible functions or pattern of this protein.

  Answer: scanprosite

• (7) Color the protein by the hydrophobicity of the amino acids.

  Answer: color