David Liu, same guy from last homework, he also isolated a cDNA 
clone from snake venom library. The nucleotide sequence of this
cDNA clone is shown here:

AAAACCATCAAATACGTTATGCTGGAATGCAACGAACTGATCCCGCTGTTCTACGAAACCT

GCCCGGCTGGTGAAAACATCTGCTACGAAATGTTCATGGTTGCTACCCCGAAAGTTCCGTGC

GAACGTGGTTGCATCGACGTTTGCCCGGAATCTTCTCTGATCGTTAAATACGTTTGCTGCAA

CACCGACCGTTGCCAGTAATCCAGCGCCTGATCTCTCGAAATAAAAGCCGCATTG 


(1) Please help him to analyze the cutting patterns of following 
    restriction enzyme: 

     EcoRI, Sau3AI, HinfI and MseI.

  ===> There is no recognition site of EcoRI in this sequence. 
       See more details  

(2) Please help him to find its corresponding polypeptide sequence.

  ===>  The most possible sequence of the 6 reading frames.
  
        M L E C N E L I P L F Y E T C P A G E N I C Y E M F M V A T 
        P K V P C E R G C I D V C P E S S L I V K Y V C C N T D R C Q  

       See the results of the translation 

(3) Please help him to identify this toxin. Is it a new toxin?

  ===> This is a new toxin. From NCBI BLAST search results  , 
       the most similar one is LO4640 . 
       However, it is so different from the query sequence.   

(4) David would like to see its structure. Could you help him to find 
    structure of this toxin or make a model if it is a new protein? 
    Show structure on 
    your homwpage ( 3 different views).